circad | circRNAs associated with diseases

Circ-UBR5
Gene	UBR5	Organism	Human
Genome Locus	n/a	Build	hg19
Disease	Non small cell Lung Cancer	ICD-10	Malignant neoplasm of bronchus and lung (C34)
DBLink	Link to database	PMID	29944885
Experimental Method
Sample Type	Tissues	Comparison	59 samples of NSCLC and paired adjacent lung tissues
Method for Estimation	Quantitative PCR and Microarrays	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward TAGTGGGCGCAGAAGCGTTGT Reverse CTTCTCCAGCCACACCCTCCAC	Statistics	Fold Change : Downregulated pvalue : p<0.05
Citation
Qin, M, Wei, G, Sun, X (2018). Circ-UBR5: An exonic circular RNA and novel small nuclear RNA involved in RNA splicing. Biochem. Biophys. Res. Commun., 503, 2:1027-1034.